LIST_OF_ANTICIPATED_GENES_OF_INTEREST.XLSX

Published: 01/19/2017

Description

Sheet1 goi primer 1 primer 1 sequence primer 2 primer 2 sequence primer 3 primer 3 sequence primer 4 primer 4 sequence 1TA 1TA-F GCA AGG GTC AGC AAT TCA AG 1TA-R1 CAG TGA AGT TGA TGT AGT AGA CTT CTA CCT G 4-1 BBL KO BBL-1B CACTGACCGACCGTGGTAATG NE...

Download Now »

Win More Government Business with GovWin IQ

With the support of GovWin's vast and experienced team of analysts, GovWin IQ's comprehensive market intelligence for U.S. federal, state, local and Canadian governments provides you qualified pre-RFP opportunities, analysis on agency budgets and priorities, insight into your competitor's business, potential partners, and key government & teaming contacts. Learn More & Try GovWin IQ for Free.

Canadian Market Intelligence from GovWin

GovWin's coverage has expanded to include the Canadian government market!

  • Streamline your business development and market research workflows across the Canadian and U.S. public sectors and empower staff by accessing opportunities from a centralized, easy-to-use platform with mobile search.
  • By bringing together the $200B purchasing powers of the provinces, the territories, their MASH sector entities, as well as the federal government, you can count on GovWin to access a holistic view of Canadian government procurement intelligence across all levels of government.
  • Our Canadian coverage includes all Federal government departments, Crown Corporations, Provincial governments, Territories, Counties, Municipalities with populations of 2,000+, First Nations with populations of 2,000+, Public Higher Ed Institutions, Purchasing Cooperatives and Special Districts.
  • Grow Market Share in Canada
    • How is your business keeping track of opportunities to work in Canada?
    • GovWin's Canadian coverage leverages numerous data sets becoming your one-stop intelligence hub so you can makes strategic go-to-market decisions and, ultimately, win more business.